Gubernur Hadiri Paripurna HUT Ke-14 Kabupaten Empat Lawang

RIMAUNEWS, EMPAT LAWANG – Meski tergolong sebagai kabupaten yang berusia muda, namun Kabupaten Empat Lawang dinilai telah mampu mensejajarkan diri dengan Kabupaten lainnya di Sumatera Selatan (Sumsel).

Pernyataan tersebut disampaikan Gubernur Sumsel H Herman Deru ketika menghadiri rapat Paripurna DPRD dalam rangka HUT ke-14 Kabupaten Empat Lawang, Rabu (21/4).

Dikatakan Herman Deru, dahsyatnya kemajuan pembangunan di Kabupaten Empat Lawang saat ini sangat dirasakan masyarakat. Terutama pembangunan yang berdampak pada pertumbuhan ekonomi dan percepatan akses yang mampu mendongkrak peningkatan potensi daerah.

“Mereka yang sebelumnya berjuang untuk pemekaran Kabupaten Empat Lawang ini tentu akan bangga melihat berbagai kemajuan ini. Kemajuan yang sangat dirasakan masyarakat ini tentu tak lepas dari semangat semua pihak,” kata Herman Deru.

Herman Deru yang kala itu didampingi Ketua TP PKK Sumsel Hj Febrita Lustia menuturkan, kekompakan di Kabupaten Empat Lawang menjadi kunci kemajuan tersebut.

“Kemajuan ini harus kita luapkan dengan rasa syukur. Karena Kabupaten Empat Lawang telah sejajar dengan Kabupaten lain. Saya turut bangga, harapan saya ini dapat terus meningkat,” ucapnya.

Kendati begitu, lanjutnya, momen HUT tersebut juga harus dijadikan sarana evaluasi serta introspeksi untuk membenahi kekurangan.

“HUT ini juga bisa dijadikan cermin untuk mengevaluasi pencapaian saat ini dan menentukan langkah kedepannya,” paparnya.

Selain itu, dalam pengelolaan pemerintahah penempatan para wanita juga sangat penting. Dimana menurutnya, wanita memiliki andil besar dalam pembangunan ini.

“Apalagi ini bertepatan dengan hari Kartini. Saya mengingatkan, peran wanita dalam pembangunan itu sangat penting. Untuk itu, wanita juga harus diberikan tempat sehingga dapat turut memberikan andilnya,” teranganya.

Sementara itu, Bupati Empat Lawang Joncik Muhammad mengatakan, evaluasi dan introspeksi diri terus dilakukan Kabupaten Empat Lawang agar bisa terus berkontribusi mendorong visi misi Sumsel Maju Untuk Semua.

“Kita terus mengevaluasi apa saja yang telah kita berikan untuk masyarakat. Artinya, kita memastikan kebutuhan yang diinginkan masyarakat,” katanya.

Dia mengaku, saat ini tata kelola pemerintahan di Kabupaten Empat Lawang yang menjadi prioritas yakni sektor kesehatan, sektor pendidikan, serta pembangunan yang memiliki manfaat luas.

“Upaya yang dilakukan tentu muaranya untuk kesejahteraan masyarakat. Untuk pembangunan, terfokus pada peingkatan infrastruktur berbasis ekonomi kerakyatan,” pungkasnya.

Tinggalkan Balasan

Alamat email Anda tidak akan dipublikasikan. Ruas yang wajib ditandai *

136 komentar

  1. hey there and thank you for your information I’ve definitely picked up anything new from right here. I did however expertise a few technical issues using this site, since I experienced to reload the site a lot of times previous to I could get it to load properly. I had been wondering if your web hosting is OK? Not that I am complaining, but sluggish loading instances times will often affect your placement in google and can damage your quality score if advertising and marketing with Adwords. Anyway I’m adding this RSS to my e-mail and can look out for a lot more of your respective intriguing content. Make sure you update this again soon.

  2. Nice post. I used to be checking continuously this blog and I am inspired! Very useful information particularly the final phase 🙂 I maintain such info a lot. I used to be seeking this particular info for a long timelong time. Thank you and good luck.

  3. Normally I do not read article on blogs, however I wish to say that this write-up very pressured me to take a look at and do so! Your writing taste has been amazed me. Thank you, quite great article.

  4. This is very interesting, You are a very skilled blogger. I have joined your feed and look forward to seeking more of your wonderful post. Also, I have shared your site in my social networks!

  5. I don’t know if it’s just me or if everyone else experiencing problems with your website. It appears as if some of the text within your posts are running off the screen. Can someone else please comment and let me know if this is happening to them too? This could be a problem with my browser because I’ve had this happen before. Appreciate it

  6. Howdy I am so happy I found your webpage, I really found you by error, while I was browsing on Bing for something else, Anyhow I am here now and would just like to say thanks a lot for a remarkable post and a all round interesting blog (I also love the theme/design), I dont have time to go through it all at the minute but I have saved it and also added in your RSS feeds, so when I have time I will be back to read much more, Please do keep up the awesome jo.

  7. In patients with PTCS, characteristic changes in sex hormones may occur priligy pill A 645 bp Cre fragment and a 336 bp ОІ actin fragment were amplified using the following primers Cre sense, AGGCGTTTTCTGAGCATACC; Cre antisense, TAGCTGGCTGGTGGCAGATG for Cre fragment; actin sense, TGAGAAGCTGGCCAAAGAGAAGGGTTAC; and actin antisense, GTGACCTGTTACTTTGGGAGTGGCAAGC for ОІ actin fragment

  8. Hmm it seems like your site ate my first comment (it was extremely long) so I guess I’ll just sum it up what I had written and say, I’m thoroughly enjoying your blog. I as well am an aspiring blog blogger but I’m still new to the whole thing. Do you have any points for novice blog writers? I’d certainly appreciate it.

  9. of course like your web-site however you need to check the spelling on quite a few of your posts. Several of them are rife with spelling problems and I in finding it very bothersome to tell the truth then again I will certainly come back again.

  10. I loved as much as you will receive carried out right here. The sketch is tasteful, your authored subject matter stylish. nonetheless, you command get bought an impatience over that you wish be delivering the following. unwell unquestionably come further formerly again since exactly the same nearly a lot often inside case you shield this increase.

  11. Hey! This is my first visit to your blog! We are a group of volunteers and starting a new initiative in a community in the same niche. Your blog provided us useful information to work on. You have done a outstanding job!

  12. I like the valuable information you supply for your articles. I will bookmark your weblog and test again here frequently. I am rather certain I will be told plenty of new stuff right here! Good luck for the following!

  13. You really make it seem so easy with your presentation but I find this topic to be really something which I think I would never understand. It seems too complicated and very broad for me. I am looking forward for your next post, I will try to get the hang of it!

  14. obviously like your web-site however you need to check the spelling on quite a few of your posts. A number of them are rife with spelling problems and I find it very bothersome to tell the truth then again I will surely come back again.

  15. First off I want to say wonderful blog! I had a quick question that I’d like to ask if you don’t mind. I was curious to know how you center yourself and clear your thoughts before writing. I have had trouble clearing my mind in getting my thoughts out. I do enjoy writing but it just seems like the first 10 to 15 minutes are generally wasted just trying to figure out how to begin. Any ideas or tips? Appreciate it!

  16. After checking out a number of the blog posts on your site, I truly like your way of blogging. I added it to my bookmark site list and will be checking back soon. Please check out my web site as well and let me know what you think.

  17. Undeniably believe that that you stated. Your favourite justification appeared to be at the net the simplest thing to understand of. I say to you, I definitely get irked at the same time as other folks consider worries that they plainly do not recognise about. You controlled to hit the nail upon the top as well as defined out the whole thing with no need side effect , folks can take a signal. Will likely be back to get more. Thank you

  18. I simply could not leave your web site prior to suggesting that I really enjoyed the standard information a person supply for your visitors? Is going to be back often in order to check up on new posts

  19. What’s Happening i’m new to this, I stumbled upon this I have found It positively helpful and it has helped me out loads. I am hoping to give a contribution & assist other users like its helped me. Good job.

  20. Thank you, I have recently been searching for information approximately this topic for ages and yours is the best I have came upon so far. However, what concerning the conclusion? Are you positive about the source?

  21. Simply want to say your article is as astonishing. The clearness on your publish is simply cool and i can assume you are knowledgeable in this subject. Well with your permission allow me to grasp your RSS feed to stay up to date with drawing close post. Thank you one million and please keep up the rewarding work.

  22. Nice post. I used to be checking continuously this blog and I am inspired! Very useful information specially the ultimate phase 🙂 I take care of such info a lot. I used to be seeking this particular info for a long timelong time. Thank you and good luck.

  23. Pretty component of content. I simply stumbled upon your web site and in accession capital to claim that I acquire in fact enjoyed account your blog posts. Any way I’ll be subscribing in your augment or even I fulfillment you get right of entry to consistently fast.

  24. Have you ever considered about including a little bit more than just your articles? I mean, what you say is fundamental and all. Nevertheless think about if you added some great photos or video clips to give your posts more, “pop”! Your content is excellent but with images and video clips, this website could certainly be one of the most beneficial in its niche. Awesome blog!

  25. Hey there! I know this is kinda off topic however , I’d figured I’d ask. Would you be interested in exchanging links or maybe guest writing a blog article or vice-versa? My website discusses a lot of the same subjects as yours and I believe we could greatly benefit from each other. If you might be interested feel free to send me an e-mail. I look forward to hearing from you! Excellent blog by the way!

  26. Хотите получить идеально ровный пол в своем доме или офисе? Обратитесь к профессионалам на сайте styazhka-pola24.ru! Мы предлагаем услуги по стяжке пола любой сложности и площади, а также устройству стяжки пола под ключ в Москве и области.

  27. Хотите получить идеально ровные стены в своей квартире или офисе? Обращайтесь к профессионалам на сайте mehanizirovannaya-shtukaturka-moscow.ru! Мы предоставляем услуги по механизированной штукатурке стен в Москве и области, а также гарантируем быстрое и качественное выполнение работ.

  28. Superb website you have here but I was curious about if you knew of any message boards that cover the same topics talked about in this article? I’d really love to be a part of online community where I can get advice from other knowledgeable individuals that share the same interest. If you have any recommendations, please let me know. Cheers!

  29. Механизированная штукатурка стен от mehanizirovannaya-shtukaturka-moscow.ru – это оптимальное сочетание цены, качества и скорости.

  30. Have you ever thought about creating an e-book or guest authoring on other websites? I have a blog centered on the same subjects you discuss and would really like to have you share some stories/information. I know my visitors would enjoy your work. If you are even remotely interested, feel free to send me an e-mail.

  31. Игра Lucky Jet на деньги – это не только развлечение, но и шанс для дополнительного дохода. Открывайте стратегии выигрыша на сайте букмекера 1win.

  32. Hi there! This is my 1st comment here so I just wanted to give a quick shout out and tell you I truly enjoy reading through your blog posts. Can you suggest any other blogs/websites/forums that go over the same subjects? Many thanks!

  33. Today, I went to the beach with my kids. I found a sea shell and gave it to my 4 year old daughter and said “You can hear the ocean if you put this to your ear.” She put the shell to her ear and screamed. There was a hermit crab inside and it pinched her ear. She never wants to go back! LoL I know this is entirely off topic but I had to tell someone!

  34. My programmer is trying to persuade me to move to .net from PHP. I have always disliked the idea because of the expenses. But he’s tryiong none the less. I’ve been using Movable-type on numerous websites for about a year and am anxious about switching to another platform. I have heard excellent things about blogengine.net. Is there a way I can transfer all my wordpress content into it? Any kind of help would be really appreciated!

  35. Wow that was odd. I just wrote an extremely long comment but after I clicked submit my comment didn’t show up. Grrrr… well I’m not writing all that over again. Anyway, just wanted to say fantastic blog!

  36. Hi there! I could have sworn I’ve been to this website before but after browsing through a few of the posts I realized it’s new to me. Nonetheless, I’m definitely pleased I came across it and I’ll be bookmarking it and checking back frequently!

  37. An impressive share! I have just forwarded this onto a coworker who had been doing a little research on this. And he in fact bought me lunch because I found it for him… lol. So let me reword this…. Thank YOU for the meal!! But yeah, thanx for spending time to discuss this matter here on your web page.

  38. Do you have a spam issue on this site; I also am a blogger, and I was curious about your situation; many of us have created some nice methods and we are looking to trade solutions with other folks, why not shoot me an e-mail if interested.